Del(11Rr313-Rr314)5Vmc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(11Rr313-Rr314)5Vmc
• Name: deletion, chr 11, Vincent M Christoffels 5
• MGI ID: MGI:7380442
• Synonyms: RE4-5^-
• Gene: Del(11Rr313-Rr314)5Vmc Location: unknown Genetic Position: Chr11, Syntenic

Mutation origin

• Strain of Origin: FVB/NRj

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Del(11Rr313-Rr314)5Vmc involves 2 genes/genome features (Rr313, Rr314) View all
• Mutation details: The adjacent cardiac Cacna1g and Epn3 enhancers, located in an intron of Cacna1g, were targeted with sgRNAs (targeting GGGCACATCCCTCAGCAGCC and GGCCCAATTAGAAGCCACCC) using CRISPR/Cas9 technology, resulting in a 3345 bp deletion. (J:295904)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Del(11Rr313-Rr314)5Vmc Mutation: 0 strains or lines available

References

• Original: J:295904 Mohan RA, et al., T-box transcription factor 3 governs a transcriptional program for the function of the mouse atrioventricular conduction system. Proc Natl Acad Sci U S A. 2020 Aug 4;117(31):18617-18626
• All: 1 reference(s)