Rr313em1Vmc
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rr313em1Vmc |
| Name: |
regulatory region 313; endonuclease-mediated mutation 1, Vincent M Christoffels |
| MGI ID: |
MGI:7380440 |
| Synonyms: |
RE4- |
| Gene: |
Rr313 Location: Chr11:94339657-94341398 bp Genetic Position: Chr11, Syntenic
|
| Alliance: |
Rr313em1Vmc page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: The cardiac Cacna1g and Epn3 enhancer, located in an intron of Cacna1g, was targeted with sgRNAs (targeting GGGCACATCCCTCAGCAGCC and GGCCAACCTCTCACTGCTGA) using CRISPR/Cas9 technology, resulting in a 1760 bp deletion.
(J:295904)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rr313 Mutation: |
0 strains or lines available
|
|
| Original: |
J:295904 Mohan RA, et al., T-box transcription factor 3 governs a transcriptional program for the function of the mouse atrioventricular conduction system. Proc Natl Acad Sci U S A. 2020 Aug 4;117(31):18617-18626 |
| All: |
1 reference(s) |
|