Rr252483^em1Vmc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr252483^em1Vmc
• Name: regulatory region 252483; endonuclease-mediated mutation 1, Vincent M Christoffels
• MGI ID: MGI:7380439
• Synonyms: RE2^-
• Gene: Rr252483 Location: Chr11:94302602-94307000 bp Genetic Position: Chr11, Syntenic
• Alliance: Rr252483^em1Vmc page

Mutation origin

• Strain of Origin: FVB/NRj

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: The cardiac Epn3 enhancer, located in an intron of Cacna1g, was targeted with sgRNAs (targeting GGATCCAGAGTCCAGACAGC and GGCTAAAGGAGACTGCTCTC) using CRISPR/Cas9 technology, resulting in a deletion. (J:295904)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr252483 Mutation: 0 strains or lines available

References

• Original: J:295904 Mohan RA, et al., T-box transcription factor 3 governs a transcriptional program for the function of the mouse atrioventricular conduction system. Proc Natl Acad Sci U S A. 2020 Aug 4;117(31):18617-18626
• All: 1 reference(s)