Rr307^em1Cdon
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr307^em1Cdon
• Name: regulatory region 307; endonuclease-mediated mutation 1, Chen Dong
• MGI ID: MGI:7367591
• Synonyms: CNS9-deficient
• Gene: Rr307 Location: Chr3:94290698-94292800 bp Genetic Position: Chr3, Syntenic
• Alliance: Rr307^em1Cdon page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The Rorc cis-regulatory element was targeted with sgRNAs (targeting AGGGTCTCAAACTATACGCC, CCGTGGCTTGGCCTAATCTC and CAACTCTCGACTATCCACTC) using CRISPR/Cas9 technology, resulting in a 2,162 bp deletion. (J:305606)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr307 Mutation: 0 strains or lines available

References

• Original: J:305606 Chang D, et al., The Conserved Non-coding Sequences CNS6 and CNS9 Control Cytokine-Induced Rorc Transcription during T Helper 17 Cell Differentiation. Immunity. 2020 Sep 15;53(3):614-626.e4
• All: 2 reference(s)