About   Help   FAQ
Rr306em1Cdon
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr306em1Cdon
Name: regulatory region 306; endonuclease-mediated mutation 1, Chen Dong
MGI ID: MGI:7367590
Synonyms: CNS6-deficent
Gene: Rr306  Location: Chr3:94283021-94284287 bp  
Alliance: Rr306em1Cdon page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsThe Rorc cis-regulatory element was targeted with sgRNAs (targeting ACAAAATGTGCCCGCTCCAC, ACGGAAACGCTGAGCAGGGC and GATGATACTGCCGCTATCGT) using CRISPR/Cas9 technology, resulting in a 1,253 bp deletion. (J:305606)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr306 Mutation:  0 strains or lines available
References
Original:  J:305606 Chang D, et al., The Conserved Non-coding Sequences CNS6 and CNS9 Control Cytokine-Induced Rorc Transcription during T Helper 17 Cell Differentiation. Immunity. 2020 Sep 15;53(3):614-626.e4
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory