About   Help   FAQ
Rasgef1cem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rasgef1cem1(IMPC)J
Name: RasGEF domain family, member 1C; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7356585
Gene: Rasgef1c  Location: Chr11:49791996-49871050 bp, + strand  Genetic Position: Chr11, 30.02 cM, cytoband B1.2
Alliance: Rasgef1cem1(IMPC)J page
IMPC: Rasgef1c gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTTATCCGCAGAATCACAG and GTCCACTTTCACCTGTCTGG, which resulted in a 2685 bp deletion beginning at Chromosome 11 position 49,966,962 bp and ending after 49,969,646 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001287950 and ENSMUSE00001274105 (exons 7 and 8) and 2492 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 238 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rasgef1c Mutation:  21 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory