Rr283^em1Hhoj
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr283^em1Hhoj
• Name: regulatory region 283; endonuclease-mediated mutation 1, Hironori Hojo
• MGI ID: MGI:7345610
• Synonyms: Sp7Enh-Ob
• Gene: Rr283 Location: Chr15:102343042-102353502 bp Genetic Position: Chr15, Syntenic
• Alliance: Rr283^em1Hhoj page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intergenic deletion
• Mutation details: CRISPR/cas9 genome editing is used to remove the Sp7 enhancer (chr15:102207224-102208686, mm9) region using single guide RNA target sequences anking the enhancer (50 sgRNA-1: ggcatctccaccgcttacgctgg; 50 sgRNA-2: ccaccgct tacgctggccacct; 30 sgRNA-1: ccaagaagttagacggggatggg; and 30 sgRNA-2: gggtggtatcccgttatttttgg). (J:328555)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr283 Mutation: 0 strains or lines available

References

• Original: J:328555 Hojo H, et al., Runx2 regulates chromatin accessibility to direct the osteoblast program at neonatal stages. Cell Rep. 2022 Sep 6;40(10):111315
• All: 1 reference(s)