About   Help   FAQ
Timm17bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Timm17bem1(IMPC)J
Name: translocase of inner mitochondrial membrane 17b; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7343917
Gene: Timm17b  Location: ChrX:7765575-7773891 bp, + strand  Genetic Position: ChrX, 3.56 cM
Alliance: Timm17bem1(IMPC)J page
IMPC: Timm17b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGCAGCCAAAGAACCAGG and CCCCACAGTCTAATATGAAA, which resulted in a 414 bp deletion beginning at Chromosome X position 7,903,461 bp and ending after 7,903,874 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000206943 (exon 3) and 350 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 42 and early truncation 34 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Timm17b Mutation:  5 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/21/2024
MGI 6.23
The Jackson Laboratory