About   Help   FAQ
Nudt16l1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Nudt16l1em1(IMPC)J
Name: nudix hydrolase 16 like 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7343888
Gene: Nudt16l1  Location: Chr16:4756975-4758892 bp, + strand  Genetic Position: Chr16, 2.48 cM, cytoband A1
Alliance: Nudt16l1em1(IMPC)J page
IMPC: Nudt16l1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GACTCCAGCTCAAGTGACAG and CTGAGGGCAACCAATCTCAG, which resulted in a 2443 bp deletion beginning at Chromosome 16 position 4,938,671 bp and ending after 4,941,113 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001438399, ENSMUSE00000127761, and ENSMUSE00001442417 (exons 1-3) and 825 bp of flanking and intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Nudt16l1 Mutation:  9 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/21/2024
MGI 6.23
The Jackson Laboratory