Stmn2^{em6(STMN2)Lutzy}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Stmn2^{em6(STMN2)Lutzy}
• Name: stathmin-like 2; endonuclease-mediated mutation 6, Cathy Lutz
• MGI ID: MGI:7343676
• Gene: Stmn2 Location: Chr3:8574587-8626664 bp, + strand Genetic Position: Chr3, 2.15 cM
• Alliance: Stmn2^{em6(STMN2)Lutzy} page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence, Inserted expressed sequence)
• Mutation: Insertion
• Stmn2^{em6(STMN2)Lutzy} expresses 1 gene
  Knock-in expresses:
  

  Organism

  Expressed Gene

  Homolog in Mouse

  Note

  human

  STMN2 (11075)

  Stmn2

  (MGI:98241)

  394 nt of human intron 1

• Mutation details: CRISPR/cas9 endonuclease-mediated genome editing ses guide RNAs to target intron 1. A double stranded DNA plasmid donor carrying 394 nt of human intron 1 genomic DNA (including 2.0kb and 1.5kb of mouse Stmn2 intron 1 DNA flanking the 394 nt human derived genomic sequence), was used in combination with mouse Stmn2 intron 1 targeting guides CACAGAATACATATCCTCAGAGG and AAAAATATTAAGCATTCACTGGGresulting in the replacement of 479 nt of murine Stmn2 intron 1 with the human-derived replacement to generate a partially humanized mouse. (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Stmn2 Mutation: 42 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)