Yap1^em1Jrt
Endonuclease-mediated Allele Detail

Summary

• Symbol: Yap1^em1Jrt
• Name: yes-associated protein 1; endonuclease-mediated mutation 1, Janet Rossant
• MGI ID: MGI:7343552
• Synonyms: YAP-emiRFP670
• Gene: Yap1 Location: Chr9:7932000-8004597 bp, - strand Genetic Position: Chr9, 2.46 cM
• Alliance: Yap1^em1Jrt page

Mutation origin

• Strain of Origin: CD-1

Mutation description

• Allele Type: Endonuclease-mediated (Reporter)
• Mutation: Insertion
• Mutation details: CRISPR/Cas9 methodologies use a gRNA (TCACGTGGTTATAGAGCTGCAGG) spanning the Stop TAG codon to introduce a fluorescent protein fused to the endogenous gene. EmiRFP670 (derived from miRFP670) is a constitutive, enhanced, monomeric, near-infrared protein whose emission maximum is 670 nm. The donating laboratory confirmed that a single copy of the fusion reporter was integrated. (J:329201)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Yap1 Mutation: 40 strains or lines available

References

• Original: J:329201 Gu B, et al., Live imaging YAP signalling in mouse embryo development. Open Biol. 2022 Jan;12(1):210335
• All: 2 reference(s)