About   Help   FAQ
Yap1em1Jrt
Endonuclease-mediated Allele Detail
Summary
Symbol: Yap1em1Jrt
Name: yes-associated protein 1; endonuclease-mediated mutation 1, Janet Rossant
MGI ID: MGI:7343552
Synonyms: YAP-emiRFP670
Gene: Yap1  Location: Chr9:7932000-8004597 bp, - strand  Genetic Position: Chr9, 2.46 cM
Alliance: Yap1em1Jrt page
Mutation
origin
Strain of Origin:  CD-1
Mutation
description
Allele Type:    Endonuclease-mediated (Reporter)
Mutation:    Insertion
 
Mutation detailsCRISPR/Cas9 methodologies use a gRNA (TCACGTGGTTATAGAGCTGCAGG) spanning the Stop TAG codon to introduce a fluorescent protein fused to the endogenous gene. EmiRFP670 (derived from miRFP670) is a constitutive, enhanced, monomeric, near-infrared protein whose emission maximum is 670 nm. The donating laboratory confirmed that a single copy of the fusion reporter was integrated. (J:329201)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Yap1 Mutation:  40 strains or lines available
References
Original:  J:329201 Gu B, et al., Live imaging YAP signalling in mouse embryo development. Open Biol. 2022 Jan;12(1):210335
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory