Ppp1r15a^em1Hato
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ppp1r15a^em1Hato
• Name: protein phosphatase 1, regulatory subunit 15A; endonuclease-mediated mutation 1, Takashi Hato
• MGI ID: MGI:7339015
• Synonyms: Ppp1r15a uORF
• Gene: Ppp1r15a Location: Chr7:45172341-45175692 bp, - strand Genetic Position: Chr7, 29.34 cM, cytoband B2
• Alliance: Ppp1r15a^em1Hato page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: CRISPR/cas9 genome editing uses guide RNAs (AGCGGGTTCATGTCGCCCTC) to create an ATG to ATA mutation, resulting in a methionine to isoleucine change, in the start codon of the third upstream open reading frame (uORF3, analogous to human uORF2). A silent protospacer adjacent motif (PAM) site mutation was introduced to prevent gRNA editing of the donor template. (J:330527)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ppp1r15a Mutation: 23 strains or lines available

References

• Original: J:330527 Kidwell A, et al., Translation Rescue by Targeting Ppp1r15a through Its Upstream Open Reading Frame in Sepsis-Induced Acute Kidney Injury in a Murine Model. J Am Soc Nephrol. 2022 Oct 25
• All: 1 reference(s)