Rr266em3Hino
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rr266em3Hino |
| Name: |
regulatory region 266; endonuclease-mediated mutation 3, Hirofumi Noguchi |
| MGI ID: |
MGI:7339001 |
| Synonyms: |
1-2 |
| Gene: |
Rr266 Location: Chr19:52252736-52252768 bp Genetic Position: Chr19, Syntenic
|
| Alliance: |
Rr266em3Hino page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutation: |
|
Intergenic deletion
|
| |
|
Mutation details: The GG2-GG1/A2-C1 enhancer element of the Ins1 promoter was targeted with sgRNAs (targeting CTTTCTGCAGACCTAGCACCAGG and AAACTGCAGCTTCAGCCCCTCTGG) using CRISPR/Cas9 technology, resulting in a 2 bp deletion (CC) in the C1 element.
(J:312429)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rr266 Mutation: |
0 strains or lines available
|
|
| Original: |
J:312429 Noguchi H, et al., In vivo evaluation of GG2-GG1/A2 element activity in the insulin promoter region using the CRISPR-Cas9 system. Sci Rep. 2021 Oct 13;11(1):20290 |
| All: |
1 reference(s) |
|