Rr266^em2Hino
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr266^em2Hino
• Name: regulatory region 266; endonuclease-mediated mutation 2, Hirofumi Noguchi
• MGI ID: MGI:7338994
• Synonyms: 1C1
• Gene: Rr266 Location: Chr19:52252736-52252768 bp Genetic Position: Chr19, Syntenic
• Alliance: Rr266^em2Hino page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The GG2-GG1/A2-C1 enhancer element of the Ins1 promoter was targeted with sgRNAs (targeting CTTTCTGCAGACCTAGCACCAGG and AAACTGCAGCTTCAGCCCCTCTGG) using CRISPR/Cas9 technology, resulting in a 3 bp deletion (CCC) in the C1 element. (J:312429)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr266 Mutation: 0 strains or lines available

References

• Original: J:312429 Noguchi H, et al., In vivo evaluation of GG2-GG1/A2 element activity in the insulin promoter region using the CRISPR-Cas9 system. Sci Rep. 2021 Oct 13;11(1):20290
• All: 1 reference(s)