Cenpa^em1Ligu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cenpa^em1Ligu
• Name: centromere protein A; endonuclease-mediated mutation 1, Guohong Li
• MGI ID: MGI:7336233
• Synonyms: CENP-A S62A
• Gene: Cenpa Location: Chr5:30824214-30832181 bp, + strand Genetic Position: Chr5, 16.76 cM
• Alliance: Cenpa^em1Ligu page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Nucleotide substitutions
• Mutation details: Serine codon 62 (AGC) in exon 2 was changed to alanine (p.S62A) using an sgRNA (targeting GGAACTTACAACCATGCTGA) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.S68A mutation and prevents phosphorylation of the residue. (J:328357)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cenpa Mutation: 15 strains or lines available

References

• Original: J:328357 Wang K, et al., Phosphorylation at Ser68 facilitates DCAF11-mediated ubiquitination and degradation of CENP-A during the cell cycle. Cell Rep. 2021 Nov 9;37(6):109987
• All: 1 reference(s)