About   Help   FAQ
Igfbp6em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Igfbp6em1(IMPC)J
Name: insulin-like growth factor binding protein 6; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7330354
Gene: Igfbp6  Location: Chr15:102052797-102057946 bp, + strand  Genetic Position: Chr15, 57.32 cM
Alliance: Igfbp6em1(IMPC)J page
IMPC: Igfbp6 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTACTGGTAGAAGTGGACCT and GGCAGTCTACTGTATTCCAA, which resulted in a 1866 bp deletion beginning at Chromosome 15 position 102,147,772 bp and ending after 102,149,637 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000285923, ENSMUSE00000133145, and ENSMUSE00000444314 (exons 2-4) and 1277 bp of flanking intronic sequence including the splice acceptor, donor as well as 3UTR is predicted to cause a change of amino acid sequence after residue 112 and early truncation 16 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Igfbp6 Mutation:  16 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/21/2024
MGI 6.23
The Jackson Laboratory