Pgpep1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pgpep1^em1(IMPC)J
• Name: pyroglutamyl-peptidase I; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7330093
• Gene: Pgpep1 Location: Chr8:71099085-71113038 bp, - strand Genetic Position: Chr8, 34.15 cM, cytoband C1
• Alliance: Pgpep1^em1(IMPC)J page
• IMPC: Pgpep1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCTAGTGTGGACCATAGCG and TCCAGGCGTGTGATTCTTGG, which resulted in a 13601 bp deletion beginning at Chromosome 8 position 70,646,368 bp and ending after 70,659,968 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000349254, ENSMUSE00000213761, ENSMUSE00000213760, ENSMUSE00000437318 and ENSMUSE00000437329 (exons 1-5) and 8718 bp of intronic sequence including the start site, splice acceptor and donor as well as 3UTR and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pgpep1 Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)