About   Help   FAQ
Syngr2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Syngr2em1(IMPC)J
Name: synaptogyrin 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7329961
Gene: Syngr2  Location: Chr11:117700494-117705109 bp, + strand  Genetic Position: Chr11, 82.96 cM
Alliance: Syngr2em1(IMPC)J page
IMPC: Syngr2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGTAGGACATATTTCCCAG and CTAGGGGTGGAGATACACTT, which resulted in a 4837 bp deletion beginning at Chromosome 11 position 117,809,495 bp and ending after 117,814,331 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001246954, ENSMUSE00000151668, ENSMUSE00001250072 and ENSMUSE00000402864 (exons 1-4) and 866 bp of flanking intronic sequence including the start site, splice acceptor and donor as well as 3 UTR and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Syngr2 Mutation:  22 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/21/2024
MGI 6.23
The Jackson Laboratory