About   Help   FAQ
Prr32em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Prr32em1(IMPC)J
Name: proline rich 32; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7328448
Gene: Prr32  Location: ChrX:44179805-44181668 bp, + strand  Genetic Position: ChrX, 24.11 cM, cytoband A3.1
Alliance: Prr32em1(IMPC)J page
IMPC: Prr32 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAGTGAAGTCATCAGTTGCT and CTACATGCCTAAAGCTAGGA, which resulted in a 2206 bp deletion beginning at Chromosome X position 45,090,823 bp and ending after 45,093,028 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000470701 and ENSMUSE00000323019 (exons 1 and 2) and 1096 bp of intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Prr32 Mutation:  5 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/21/2024
MGI 6.23
The Jackson Laboratory