Rr44605em2Ddu
Endonuclease-mediated Allele Detail
|
Symbol: |
Rr44605em2Ddu |
Name: |
regulatory region 44605; endonuclease-mediated mutation 2, Denis Duboule |
MGI ID: |
MGI:7327113 |
Synonyms: |
deltaCB4', deltaCBS4' |
Gene: |
Rr44605 Location: Chr2:74522001-74522400 bp Genetic Position: Chr2, Syntenic
|
Alliance: |
Rr44605em2Ddu page
|
|
Strain of Origin: |
C57BL/6 x CBA
|
|
Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
Mutation: |
|
Intergenic deletion
|
|
|
Mutation details: Using two sgRNAs (targeting GCGCCTGTGATAGTGCGCGT and CGCTGTTGTCCGTGCTTACG) with CRISPR/Cas9 technology, a 45 bp deletion (CGCACTATCACAGGCGCTTAGTAGATGTCGCTGTTGTCCGTGCTT) was created in this Hoxd CTCF binding site region.
(J:319862)
|
|
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Rr44605 Mutation: |
0 strains or lines available
|
|
Original: |
J:319862 Amandio AR, et al., Sequential in cis mutagenesis in vivo reveals various functions for CTCF sites at the mouse HoxD cluster. Genes Dev. 2021 Nov 1;35(21-22):1490-1509 |
All: |
1 reference(s) |
|