Epha1^em1Aduci
Endonuclease-mediated Allele Detail

Summary

• Symbol: Epha1^em1Aduci
• Name: Eph receptor A1; endonuclease-mediated mutation 1, Frank LaFerla
• MGI ID: MGI:7327103
• Synonyms: Epha1-P461L
• Gene: Epha1 Location: Chr6:42335421-42350202 bp, - strand Genetic Position: Chr6, 20.65 cM
• Alliance: Epha1^em1Aduci page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Guide RNAs (AGCTGGTGAAGAAAGAACCG and CAAGTCAGCTCCAGCTGCCT) are designed to create a CCG to TTG missense mutation resulting in a proline to leucine mutation (P461L) orthologous to the location of human SNP rs202178565 in the Eph receptor A1 (Epha1) gene. Human SNP rs202178565 has been found in human EPHA1 and is associated with increased risk of sporadic Alzheimer's disease (AD). (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Epha1 Mutation: 48 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)