Rr207^em1LinJ
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr207^em1LinJ
• Name: regulatory region 207; endonuclease-mediated mutation 1, Lin Jiang
• MGI ID: MGI:7316892
• Synonyms: TBX3 enhancer KO
• Gene: Rr207 Location: Chr5:119805828-119806479 bp Genetic Position: Chr5, Syntenic
• Alliance: Rr207^em1LinJ page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Single point mutation
• Mutation details: An A-to-G mutation was engineered in this Tbx3 enhancer using sgRNAs (targeting GGCAAGCCAGAGAAACGGGAAGG and GGGAGGTCAGTCATAATTGGCGG) and an ssODN template (GCGTCTGGGAGGTCAGTCGTAATTGGCGGAAGTTT) with CRISPR/Cas9 technology. (J:320102)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr207 Mutation: 0 strains or lines available

References

• Original: J:320102 Liu X, et al., A single-nucleotide mutation within the TBX3 enhancer increased body size in Chinese horses. Curr Biol. 2022 Jan 24;32(2):480-487.e6
• All: 1 reference(s)