In(11Myh1;Myh4)2Mair
Endonuclease-mediated Allele Detail

Summary

• Symbol: In(11Myh1;Myh4)2Mair
• Name: inversion, Chr11, Pascal Maire 2
• MGI ID: MGI:7285975
• Synonyms: Myh(1-4)^Inv3'
• Gene: In(11Myh1;Myh4)2Mair Location: unknown Genetic Position: Chr11, Syntenic

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Inversion
• In(11Myh1;Myh4)2Mair involves 2 genes/genome features (Myh1, Myh4) View all
• Mutation details: The genomic sequence containing Myh1 and the 5' end of Myh4 was inverted using sgRNAs (targeting ATGAGTGTGTGGCTAGGCAACGG, GTGGCTAGGCAACGGTTTGGGGG, ATGATTTGACAGTGAGTCAGAGG, GGGTTCTCATGCTAACACAGAGG, AAGTGAAGTGGATAACCACAGGG and CAGAATGGCAGACGGCCCTGTGG) with CRISPR/Cas9 technology. (J:322002)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any In(11Myh1;Myh4)2Mair Mutation: 0 strains or lines available

References

• Original: J:322002 Dos Santos M, et al., A fast Myosin super enhancer dictates muscle fiber phenotype through competitive interactions with Myosin genes. Nat Commun. 2022 Feb 24;13(1):1039
• All: 1 reference(s)