About   Help   FAQ
In(11Myh1;Myh4)1Mair
Endonuclease-mediated Allele Detail
Summary
Symbol: In(11Myh1;Myh4)1Mair
Name: inversion, Chr11, Pascal Maire 1
MGI ID: MGI:7285973
Synonyms: Myh(1-4)Inv
Gene: In(11Myh1;Myh4)1Mair  Location: Chr11:67090295-67152081 bp  Genetic Position: Chr11, Syntenic
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Inversion
  In(11Myh1;Myh4)1Mair involves 2 genes/genome features (Myh1, Myh4) View all
 
Mutation detailsThe genomic sequence containing Myh1 and Myh4 (chr11:67090295-67152081 GRCm39) was inverted using sgRNAs (targeting ATGAGTGTGTGGCTAGGCAACGG, GTGGCTAGGCAACGGTTTGGGGG, ATGATTTGACAGTGAGTCAGAGG, GGGTTCTCATGCTAACACAGAGG, AAGTGAAGTGGATAACCACAGGG and CAGAATGGCAGACGGCCCTGTGG) with CRISPR/Cas9 technology. (J:322002)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any In(11Myh1;Myh4)1Mair Mutation:  0 strains or lines available
References
Original:  J:322002 Dos Santos M, et al., A fast Myosin super enhancer dictates muscle fiber phenotype through competitive interactions with Myosin genes. Nat Commun. 2022 Feb 24;13(1):1039
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory