Del(11Myh1-Myh4)1Mair
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Del(11Myh1-Myh4)1Mair |
| Name: |
deletion, Chr11, Pascal Maire 1 |
| MGI ID: |
MGI:7285972 |
| Synonyms: |
Myh(1-4)Del |
| Gene: |
Del(11Myh1-Myh4)1Mair Location: Chr11:67090357-67152023 bp Genetic Position: Chr11, Syntenic
|
|
| Strain of Origin: |
Not Applicable
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutations: |
|
Intergenic deletion, Intragenic deletion
|
|
|
Del(11Myh1-Myh4)1Mair involves 2 genes/genome features (Myh1, Myh4)
View all
|
| |
|
Mutation details: The genomic sequence containing Myh1 and Myh4 (chr11:67090357-67152023 GRCm39) was deleted using sgRNAs (targeting ATGAGTGTGTGGCTAGGCAACGG, GTGGCTAGGCAACGGTTTGGGGG, ATGATTTGACAGTGAGTCAGAGG, GGGTTCTCATGCTAACACAGAGG, AAGTGAAGTGGATAACCACAGGG and CAGAATGGCAGACGGCCCTGTGG) with CRISPR/Cas9 technology.
(J:322002)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Del(11Myh1-Myh4)1Mair Mutation: |
0 strains or lines available
|
|
| Original: |
J:322002 Dos Santos M, et al., A fast Myosin super enhancer dictates muscle fiber phenotype through competitive interactions with Myosin genes. Nat Commun. 2022 Feb 24;13(1):1039 |
| All: |
1 reference(s) |
|