Rr195^em1Mair
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr195^em1Mair
• Name: regulatory region 195; endonuclease-mediated mutation 1, Pascal Maire
• MGI ID: MGI:7285969
• Synonyms: EnhA^-
• Gene: Rr195 Location: Chr11:67029517-67036375 bp Genetic Position: Chr11, Syntenic
• Alliance: Rr195^em1Mair page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: Myh enhancer A, a sub-region of super enhancer Rr194, was deleted using sgRNAs (targeting GAGAAGAGTCTCGTCATTGTGG, GTCACACTGCCCATCCTCGAGGG, GATGTTCTGCCCTCGAGGATGGG, GATGGAAGGACCCCTAATTAGG, GCAGACAAGGCCTTCAATTAGGGG and GTCTCTGACATCAAGCCATGCAGG) with CRISPR/Cas9 technology. The deletion covers chr11:67029517-67036375 (GRCm39). (J:322002)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr195 Mutation: 0 strains or lines available

References

• Original: J:322002 Dos Santos M, et al., A fast Myosin super enhancer dictates muscle fiber phenotype through competitive interactions with Myosin genes. Nat Commun. 2022 Feb 24;13(1):1039
• All: 1 reference(s)