Spo11^em1Amp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Spo11^em1Amp
• Name: SPO11 initiator of meiotic double stranded breaks; endonuclease-mediated mutation 1, Alberto M Pendas
• MGI ID: MGI:7281852
• Synonyms: Spo11^-
• Gene: Spo11 Location: Chr2:172819493-172835369 bp, + strand Genetic Position: Chr2, 95.64 cM, cytoband H4
• Alliance: Spo11^em1Amp page

Mutation origin

• Strain of Origin: (C57BL/6J x CBA/J)F2

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Nucleotide substitutions
• Mutation details: CRISPR/Cas9 technology, using sgRNAs (targeting TATGTCTCTATGCAGATGCA and ACACTGACAGCCAGCTCTTT) and an ssODN template, generated a TACTAC to TTCTTC change in exon 5, resulting in tyrosine to phenylalanine substitutions at amino acids 137 and 138 (p.Y112_Y113delinsFF), and inserted (duplicated) a T further downstream, leading to a frameshift and premature stop codon (p.Gly145Leufs*18). (J:303558)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Spo11 Mutation: 22 strains or lines available

References

• Original: J:303558 Felipe-Medina N, et al., A missense in HSF2BP causing primary ovarian insufficiency affects meiotic recombination by its novel interactor C19ORF57/BRME1. Elife. 2020 Aug 26;9:e56996
• All: 1 reference(s)