About   Help   FAQ
Adarem1Stsn
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Adarem1Stsn
Name: adenosine deaminase, RNA-specific; endonuclease-mediated mutation 1, Daniel B Stetson
MGI ID: MGI:7281512
Synonyms: AdarP195A
Gene: Adar  Location: Chr3:89622329-89660753 bp, + strand  Genetic Position: Chr3, 39.19 cM, cytoband F2
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsUsing an sgRNA (targeting GAAGGGGGAAACCTCCTTTGTGG) and an ssODN template (ATCAATCGTATTTTGTACTCCCTGGAAAAGAAGGGAAAGCTGCACAGAGGAAGGGGGAAACCTGCCTTGTGGAGCCTTGTGCCCTTGAGTCAGGCTTGGACTCAGCCCCCTGGAGTTGTGAATCCAGAT) with CRISPR/Cas9 technology, proline codon 195 (CCT) was changed to alanine (GCC) (p.P195A). The mutation affects the Z-alpha Z-DNA-binding domain in the encoded peptide and is equivalent to the p.P193A mutation found in Aicardi-Goutieres syndrome (AGS) patients. (J:308678)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Expression
In Structures Affected by this Mutation: 5 anatomical structures
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Adar Mutation:  58 strains or lines available
References
Original:  J:308678 Maurano M, et al., Protein kinase R and the integrated stress response drive immunopathology caused by mutations in the RNA deaminase ADAR1. Immunity. 2021 Jul 29;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
09/27/2022
MGI 6.21
The Jackson Laboratory