Egln3^em1Jianf
Endonuclease-mediated Allele Detail

Summary

• Symbol: Egln3^em1Jianf
• Name: egl-9 family hypoxia-inducible factor 3; endonuclease-mediated mutation 1, Jian Fu
• MGI ID: MGI:7279291
• Synonyms: EGLN3 KI, EGLN3R205K
• Gene: Egln3 Location: Chr12:54225767-54250646 bp, - strand Genetic Position: Chr12, 22.9 cM
• Alliance: Egln3^em1Jianf page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Single point mutation
• Mutation details: Using an sgRNA (targeting ATGCCACCAGGTAAGAGCTG) and an ssODN template (TTCTGTTCTTCTGGTCAGACCGCAGGAATCCACATGAAGTCCAGCCCTCCTATGCCACGAAGTAAGAGCTGGGGCCACAGTTCCTCTTCCAGGGTGCATACAAACCCCAGATCCCCG) with CRISPR/Cas9 technology, arginine codon 205 (AGG) was changed to lysine (AAG) (c.614G>A, p.R205K). This mutation affects the hydroxylase activity of the encoded protein. (J:322768)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Egln3 Mutation: 24 strains or lines available

References

• Original: J:322768 Jin Y, et al., Inactivation of EGLN3 hydroxylase facilitates Erk3 degradation via autophagy and impedes lung cancer growth. Oncogene. 2022 Mar;41(12):1752-1766
• All: 1 reference(s)