Egln3em1Jianf
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Egln3em1Jianf |
| Name: |
egl-9 family hypoxia-inducible factor 3; endonuclease-mediated mutation 1, Jian Fu |
| MGI ID: |
MGI:7279291 |
| Synonyms: |
EGLN3 KI, EGLN3R205K |
| Gene: |
Egln3 Location: Chr12:54225767-54250646 bp, - strand Genetic Position: Chr12, 22.9 cM
|
| Alliance: |
Egln3em1Jianf page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Not Specified) |
| Mutation: |
|
Single point mutation
|
| |
|
Mutation details: Using an sgRNA (targeting ATGCCACCAGGTAAGAGCTG) and an ssODN template (TTCTGTTCTTCTGGTCAGACCGCAGGAATCCACATGAAGTCCAGCCCTCCTATGCCACGAAGTAAGAGCTGGGGCCACAGTTCCTCTTCCAGGGTGCATACAAACCCCAGATCCCCG) with CRISPR/Cas9 technology, arginine codon 205 (AGG) was changed to lysine (AAG) (c.614G>A, p.R205K). This mutation affects the hydroxylase activity of the encoded protein.
(J:322768)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Egln3 Mutation: |
26 strains or lines available
|
|
| Original: |
J:322768 Jin Y, et al., Inactivation of EGLN3 hydroxylase facilitates Erk3 degradation via autophagy and impedes lung cancer growth. Oncogene. 2022 Mar;41(12):1752-1766 |
| All: |
1 reference(s) |
|