About   Help   FAQ
Egln3em1Jianf
Endonuclease-mediated Allele Detail
Summary
Symbol: Egln3em1Jianf
Name: egl-9 family hypoxia-inducible factor 3; endonuclease-mediated mutation 1, Jian Fu
MGI ID: MGI:7279291
Synonyms: EGLN3 KI, EGLN3R205K
Gene: Egln3  Location: Chr12:54225767-54250646 bp, - strand  Genetic Position: Chr12, 22.9 cM
Alliance: Egln3em1Jianf page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Single point mutation
 
Mutation detailsUsing an sgRNA (targeting ATGCCACCAGGTAAGAGCTG) and an ssODN template (TTCTGTTCTTCTGGTCAGACCGCAGGAATCCACATGAAGTCCAGCCCTCCTATGCCACGAAGTAAGAGCTGGGGCCACAGTTCCTCTTCCAGGGTGCATACAAACCCCAGATCCCCG) with CRISPR/Cas9 technology, arginine codon 205 (AGG) was changed to lysine (AAG) (c.614G>A, p.R205K). This mutation affects the hydroxylase activity of the encoded protein. (J:322768)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Egln3 Mutation:  26 strains or lines available
References
Original:  J:322768 Jin Y, et al., Inactivation of EGLN3 hydroxylase facilitates Erk3 degradation via autophagy and impedes lung cancer growth. Oncogene. 2022 Mar;41(12):1752-1766
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory