Mlh1em7Jcs
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Mlh1em7Jcs |
| Name: |
mutL homolog 1; endonuclease-mediated mutation 7, John C Schimenti |
| MGI ID: |
MGI:7276208 |
| Synonyms: |
Mlh1K618A |
| Gene: |
Mlh1 Location: Chr9:111057296-111100854 bp, - strand Genetic Position: Chr9, 60.92 cM
|
| Alliance: |
Mlh1em7Jcs page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details: Using an sgRNA (targeting AGGACGACGGCCCGAAGGAA) and an ssODN template (AAGTGGCTGGACAGAGGACGACGGCCCGAAAGAGGGCCTTGCAGAGTACATTGTTGAGTTTCTGAAGAAGGCAGCGGAGATGCTTGCAGACTATTTCTCTGTGGAGATCGATGAGGCGAG) with CRISPR/Cas9 technology, lysine codon 622 (AAA) was changed to alanine (GCA) (c.1864_1865delAAinsGC, p.K622A). This is the equivalent of the human p.K618A mutation.
(J:324056)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Mlh1 Mutation: |
41 strains or lines available
|
|
| Original: |
J:324056 Singh P, et al., Human MLH1/3 variants causing aneuploidy, pregnancy loss, and premature reproductive aging. Nat Commun. 2021 Aug 18;12(1):5005 |
| All: |
1 reference(s) |
|