Mlh1^em6Jcs
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mlh1^em6Jcs
• Name: mutL homolog 1; endonuclease-mediated mutation 6, John C Schimenti
• MGI ID: MGI:7276207
• Synonyms: Mlh1^V716M
• Gene: Mlh1 Location: Chr9:111057296-111100854 bp, - strand Genetic Position: Chr9, 60.92 cM
• Alliance: Mlh1^em6Jcs page

Mutation origin

• Strain of Origin: FVB/NJ x B6(Cg)-Tyr^c-2J/J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Using an sgRNA (targeting CCACTTCCAGGGCTTTGACG) and an ssODN template (TGTGAAATGCTTCGGAGGTAGGAGGTGTGAGCGGAAGGCTTTATAGATAATGTGCTCCATAGTCCACTTCCAGGGCTTAGAGGTCGAGCCAGGCATGTCACTCTGGAAAATATATGACAC) with CRISPR/Cas9 technology, valine codon 720 (GTG) was changed to methionine (ATG) (c.2158G>A, p.V720M). This is the equivalent of the human p.V716M mutation. (J:324056)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mlh1 Mutation: 42 strains or lines available

References

• Original: J:324056 Singh P, et al., Human MLH1/3 variants causing aneuploidy, pregnancy loss, and premature reproductive aging. Nat Commun. 2021 Aug 18;12(1):5005
• All: 1 reference(s)