Mlh1^em4Jcs
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mlh1^em4Jcs
• Name: mutL homolog 1; endonuclease-mediated mutation 4, John C Schimenti
• MGI ID: MGI:7276205
• Synonyms: Mlh1^K618T
• Gene: Mlh1 Location: Chr9:111057296-111100854 bp, - strand Genetic Position: Chr9, 60.92 cM
• Alliance: Mlh1^em4Jcs page

Mutation origin

• Strain of Origin: FVB/NJ x B6(Cg)-Tyr^c-2J/J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Using an sgRNA (targeting AGGACGACGGCCCGAAGGAA) and an ssODN template (AAGTGGCTGGACAGAGGACGACGGCCCGAAAGAGGGCCTTGCAGAGTACATTGTTGAGTTTCTGAAGAAGACAGCGGAGATGCTTGCAGACTATTTCTCTGTGGAGATCGATGAGGCGAG) with CRISPR/Cas9 technology, lysine codon 622 (AAA) was changed to threonine (ACA) (c.1865A>C, p.K622T). This is the equivalent of the human p.K618T mutation. (J:324056)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mlh1 Mutation: 41 strains or lines available

References

• Original: J:324056 Singh P, et al., Human MLH1/3 variants causing aneuploidy, pregnancy loss, and premature reproductive aging. Nat Commun. 2021 Aug 18;12(1):5005
• All: 1 reference(s)