Mlh3^em2Jcs
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mlh3^em2Jcs
• Name: mutL homolog 3; endonuclease-mediated mutation 2, John C Schimenti
• MGI ID: MGI:7276201
• Synonyms: Mlh3^R1230H
• Gene: Mlh3 Location: Chr12:85281294-85317373 bp, - strand Genetic Position: Chr12, 39.61 cM
• Alliance: Mlh3^em2Jcs page

Mutation origin

• Strain of Origin: FVB/NJ x B6(Cg)-Tyr^c-2J/J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Using an sgRNA (targeting GCTCCAAACGAATGCGTTCA) and an ssODN template (CTTAAATCTCCTCTAACTACAGACAGATACTTACCAGTAATAAGCTGCTCCAAACGTATGTGTTCATGTGCAGCATGCTGGTCCACCAGGACTAACAGGTTTCCACCTACAAAATAATCC) with CRISPR/Cas9 technology, arginine codon 1192 (CGC) was changed to histidine (CAC) (c.3575G>A, p.R1192H). This is the equivalent of the human p.R1230H mutation. (J:324056)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mlh3 Mutation: 78 strains or lines available

References

• Original: J:324056 Singh P, et al., Human MLH1/3 variants causing aneuploidy, pregnancy loss, and premature reproductive aging. Nat Commun. 2021 Aug 18;12(1):5005
• All: 1 reference(s)