Ddc^em2Gregg
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ddc^em2Gregg
• Name: dopa decarboxylase; endonuclease-mediated mutation 2, Christopher Gregg
• MGI ID: MGI:7266270
• Synonyms: Ddc^V5
• Gene: Ddc Location: Chr11:11764101-11848144 bp, - strand Genetic Position: Chr11, 7.09 cM, cytoband A1-A4
• Alliance: Ddc^em2Gregg page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Epitope tag, Reporter)
• Mutation: Insertion
• Mutation details: A crRNA (AAUGAAAGCAGAGCUGCUUC) was designed to insert the Ddc40HA-V5-P2A-mRuby2-3xNLS construct immediately before the stop codon of the gene. Specifically, the construct contained (from 5'; to 3') the last 40 bp of Ddc coding sequence c-terminally conjugated with a V5 epitope tag, P2A self-cleaving peptide sequence, mRuby2 conjugated with three c-terminal copies of a nuclear localization sequence (3xNLS), stop codon, 37 bp of mutated Ddc 3'-UTR (mUTR) to prevent homology repair between the stop codon and a CRISPR cut site 34 bp downstream (preserving the 3';-splice junction of exon 14), followed by 40 bp of un-mutated Ddc intron 14 sequence. (J:324028)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ddc Mutation: 128 strains or lines available

References

• Original: J:324028 Bonthuis PJ, et al., Noncanonical genomic imprinting in the monoamine system determines naturalistic foraging and brain-adrenal axis functions. Cell Rep. 2022 Mar 8;38(10):110500
• All: 1 reference(s)