About   Help   FAQ
C3em1Takah
Endonuclease-mediated Allele Detail
Summary
Symbol: C3em1Takah
Name: complement component 3; endonuclease-mediated mutation 1, Takeshi Takahashi
MGI ID: MGI:7261227
Synonyms: C3deltaMG2-3
Gene: C3  Location: Chr17:57510970-57535136 bp, - strand  Genetic Position: Chr17, 29.72 cM, cytoband E1-E3
Alliance: C3em1Takah page
Mutation
origin
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/cas9 mediated recombination using 2 guide RNAs (CTTGACAGGAATGCCATCGG and CATCGATGACCCAAATGGCC) targeting exons 5 and 7 was used to create a 252 bp deletion spanning nucleotides 614 - 865 including all of exon 6 and parts of exons 5 and 7. ELISA confirmed the absence of mature protein in plasma from homozygous mice. (J:323044)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any C3 Mutation:  100 strains or lines available
References
Original:  J:323044 Yamaguchi T, et al., Generation of Novel Human Red Blood Cell-Bearing Humanized Mouse Models Based on C3-Deficient NOG Mice. Front Immunol. 2021;12:671648
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory