C3^em1Takah
Endonuclease-mediated Allele Detail

Summary

• Symbol: C3^em1Takah
• Name: complement component 3; endonuclease-mediated mutation 1, Takeshi Takahashi
• MGI ID: MGI:7261227
• Synonyms: C3^deltaMG2-3
• Gene: C3 Location: Chr17:57510970-57535136 bp, - strand Genetic Position: Chr17, 29.72 cM, cytoband E1-E3
• Alliance: C3^em1Takah page

Mutation origin

• Strain of Origin: NOD.Cg-Prkdc^scid Il2rg^tm1Sug/ShiJic

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 mediated recombination using 2 guide RNAs (CTTGACAGGAATGCCATCGG and CATCGATGACCCAAATGGCC) targeting exons 5 and 7 was used to create a 252 bp deletion spanning nucleotides 614 - 865 including all of exon 6 and parts of exons 5 and 7. ELISA confirmed the absence of mature protein in plasma from homozygous mice. (J:323044)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any C3 Mutation: 100 strains or lines available

References

• Original: J:323044 Yamaguchi T, et al., Generation of Novel Human Red Blood Cell-Bearing Humanized Mouse Models Based on C3-Deficient NOG Mice. Front Immunol. 2021;12:671648
• All: 1 reference(s)