About   Help   FAQ
Zfhx4em2(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfhx4em2(IMPC)J
Name: zinc finger homeodomain 4; endonuclease-mediated mutation 2, Jackson
MGI ID: MGI:7258496
Gene: Zfhx4  Location: Chr3:5283586-5480917 bp, + strand  Genetic Position: Chr3, 1.96 cM, cytoband A1
Alliance: Zfhx4em2(IMPC)J page
IMPC: Zfhx4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by microinjecting Cas9 mRNA and 2 guide sequences GGGTTATCTAAACAGAAGAC and TGGGTACCTTTAGCTTAAAA, which resulted in a 999 bp deletion beginning at Chromosome 3 position 5,396,372 bp and ending after 5,397,370 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000149284 and ENSMUSE00000512464 (exons 7 and 8) and 667 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 1142 and early truncation 4 amino acids later. There is a 1 bp insertion [G] at the deletion site. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Zfhx4 Mutation:  156 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory