Zfhx4^em2(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfhx4^em2(IMPC)J
• Name: zinc finger homeodomain 4; endonuclease-mediated mutation 2, Jackson
• MGI ID: MGI:7258496
• Gene: Zfhx4 Location: Chr3:5283586-5480917 bp, + strand Genetic Position: Chr3, 1.96 cM, cytoband A1
• Alliance: Zfhx4^em2(IMPC)J page
• IMPC: Zfhx4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by microinjecting Cas9 mRNA and 2 guide sequences GGGTTATCTAAACAGAAGAC and TGGGTACCTTTAGCTTAAAA, which resulted in a 999 bp deletion beginning at Chromosome 3 position 5,396,372 bp and ending after 5,397,370 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000149284 and ENSMUSE00000512464 (exons 7 and 8) and 667 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 1142 and early truncation 4 amino acids later. There is a 1 bp insertion [G] at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Zfhx4 Mutation: 156 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)