Casp8^em4Jhan
Endonuclease-mediated Allele Detail

Summary

• Symbol: Casp8^em4Jhan
• Name: caspase 8; endonuclease-mediated mutation 4, Jiahuai Han
• MGI ID: MGI:7258417
• Synonyms: Casp8^C362S
• Gene: Casp8 Location: Chr1:58834553-58886663 bp, + strand Genetic Position: Chr1, 29.19 cM, cytoband B
• Alliance: Casp8^em4Jhan page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Single point mutation
• Mutation details: Using sgRNAs (targeting GTGTCGTCTATGGAACGGAT and GCCCATTAGAAGGTGCTTTA) and an ssODN template with CRISPR/Cas9 technology, cysteine codon 362 (TGC) was changed to serine (TCC) (p.C362S). This mutation allows the residue to be phosphorylated in the encoded peptide. (J:297236)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Casp8 Mutation: 45 strains or lines available

References

• Original: J:297236 Yang ZH, et al., A Non-canonical PDK1-RSK Signal Diminishes Pro-caspase-8-Mediated Necroptosis Blockade. Mol Cell. 2020 Oct 15;80(2):296-310.e6
• All: 1 reference(s)