About   Help   FAQ
Casp8em3Jhan
Endonuclease-mediated Allele Detail
Summary
Symbol: Casp8em3Jhan
Name: caspase 8; endonuclease-mediated mutation 3, Jiahuai Han
MGI ID: MGI:7258416
Synonyms: Casp8T265A
Gene: Casp8  Location: Chr1:58834553-58886663 bp, + strand  Genetic Position: Chr1, 29.19 cM, cytoband B
Alliance: Casp8em3Jhan page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsUsing an sgRNA (targeting AAAGGAACAGACTGTGATAA) and an ssODN template with CRISPR/Cas9 technology, threonine codon 265 (ACA) was changed to alanine (GCC) (p.T265A). This is a phosphoblocking mutation that prevents the residue from being phosphorylated in the encoded peptide. (J:297236)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Casp8 Mutation:  45 strains or lines available
References
Original:  J:297236 Yang ZH, et al., A Non-canonical PDK1-RSK Signal Diminishes Pro-caspase-8-Mediated Necroptosis Blockade. Mol Cell. 2020 Oct 15;80(2):296-310.e6
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory