About   Help   FAQ
Zmynd10em2Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Zmynd10em2Tcp
Name: zinc finger, MYND domain containing 10; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:7256944
Gene: Zmynd10  Location: Chr9:107424497-107428518 bp, + strand  Genetic Position: Chr9, 58.12 cM
Alliance: Zmynd10em2Tcp page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, No functional change)
Mutation:    Insertion
 
Mutation details:  This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences AGGAGAACTAGGGCCGCCCT and CTCCACCTTGTTCTGACGTC. This resulted in insertions of 48 bp (location: chr9:107425550; GRCm39), 50 bp (location: chr9:107426954; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Zmynd10 Mutation:  22 strains or lines available
References
Original:  J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/08/2026
MGI 6.24
The Jackson Laboratory