Epha2^em1Alsh
Endonuclease-mediated Allele Detail

Summary

• Symbol: Epha2^em1Alsh
• Name: Eph receptor A2; endonuclease-mediated mutation 1, Alan Shiels
• MGI ID: MGI:7256468
• Synonyms: Epha2-mutant
• Gene: Epha2 Location: Chr4:141028551-141056695 bp, + strand Genetic Position: Chr4, 73.67 cM, cytoband D-E
• Alliance: Epha2^em1Alsh page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Using sgRNAs (targeting GTTCAGTGTACTTCAGTTGGNGG and TTCAGTGTACTTCAGTTGGTNGG) and an SSODN template (GGCCAGGTCCCGGTGCACGTAGTTCATGTTGGCCAGGTACTTCATGCCGGATGCGATACCCTGCAGCATGCCCACTAGCTGAAGTACACTGAACTCACCATCCTTCTCCTGCAGAGATAGGCCCTCAGTGCTGACCGG) with CRISPR/Cas9 technology, arginine codon 722 (AGG) in exon 13 was changed to glutamine (CAG) (p.R722Q). The equivalent p.R721Q human mutation is associated with age-related cortical cataract. (J:312486)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Epha2 Mutation: 97 strains or lines available

References

• Original: J:312486 Zhou Y, et al., Mutation of the EPHA2 Tyrosine-Kinase Domain Dysregulates Cell Pattern Formation and Cytoskeletal Gene Expression in the Lens. Cells. 2021 Sep 30;10(10)
• All: 1 reference(s)