Brcc3^em1Bfpy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Brcc3^em1Bfpy
• Name: BRCA1/BRCA2-containing complex, subunit 3; endonuclease-mediated mutation 1, Benedicte F Py
• MGI ID: MGI:7254894
• Synonyms: Brcc3^-
• Gene: Brcc3 Location: ChrX:74460234-74497607 bp, + strand Genetic Position: ChrX, 38.22 cM
• Alliance: Brcc3^em1Bfpy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Using a crRNA (AGUGAUGGGUCUGUGUAUAGGUUUUAGAGCUAUGCUGUUUUG) with CRISPR/Cas9 technology, a 2 bp deletion (TA) was created in the coding region of exon 1, causing a frameshift and premature stop codon. (J:313659)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Brcc3 Mutation: 11 strains or lines available

References

• Original: J:313659 Niu T, et al., NLRP3 phosphorylation in its LRR domain critically regulates inflammasome assembly. Nat Commun. 2021 Oct 6;12(1):5862
• All: 1 reference(s)