Slc26a4^em2Chch
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc26a4^em2Chch
• Name: solute carrier family 26, member 4; endonuclease-mediated mutation 2, Chen-Chi Wu
• MGI ID: MGI:7254859
• Synonyms: Slc26a4^C565Y
• Gene: Slc26a4 Location: Chr12:31569826-31609968 bp, - strand Genetic Position: Chr12, 13.53 cM, cytoband B1
• Alliance: Slc26a4^em2Chch page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Using an sgRNA (targeting ATTTTTTACGGCAATGTCGA) and an ssODN template with CRISPR/Cas9 technology, cysteine codon 565 (TGT) in exon 15 was changed to tyrosine (TAT) (c.1694G>A, p.C565Y); also, two silent mutations were introduced to create a diagnostic AclI restriction site. This mutation mimics a human mutation associated with sensorineural hearing impairment (SNHI) but doesn't cause deafness in mouse. (J:321807)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Slc26a4 Mutation: 42 strains or lines available

References

• Original: J:321807 Hu CJ, et al., Toward the Pathogenicity of the SLC26A4 p.C565Y Variant Using a Genetically Driven Mouse Model. Int J Mol Sci. 2021 Mar 10;22(6)
• All: 1 reference(s)