Slc26a4^em1Chch
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc26a4^em1Chch
• Name: solute carrier family 26, member 4; endonuclease-mediated mutation 1, Chen-Chi Wu
• MGI ID: MGI:6890464
• Synonyms: Slc26a4^T721M
• Gene: Slc26a4 Location: Chr12:31569826-31609968 bp, - strand Genetic Position: Chr12, 13.53 cM, cytoband B1
• Alliance: Slc26a4^em1Chch page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Using an sgRNA (targeting AAAGGACAGATTCTTTCTGA) and an ssODN template with CRISPR/Cas9 technology, threnonine codon 721 (ACG) in exon 15 was changed to methionine (ATG) (c.2162C>T, p.T721M); also, two silent mutations were introduced to create a diagnostic HinfI restriction site. This mutation mimics a human mutation associated with sensorineural hearing impairment (SNHI) but doesn't cause deafness in mouse. (J:313809)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Slc26a4 Mutation: 42 strains or lines available

References

• Original: J:313809 Hu CJ, et al., Insights into phenotypic differences between humans and mice with p.T721M and other C-terminal variants of the SLC26A4 gene. Sci Rep. 2021 Oct 25;11(1):20983
• All: 1 reference(s)