Atxn2^em4Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Atxn2^em4Lutzy
• Name: ataxin 2; endonuclease-mediated mutation 4, Cathleen Lutz
• MGI ID: MGI:6887967
• Synonyms: Atxn2^delEx2
• Gene: Atxn2 Location: Chr5:121849672-121954372 bp, + strand Genetic Position: Chr5, 61.93 cM, cytoband F
• Alliance: Atxn2^em4Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 genome editing used guide RNAs [TCCTGTCACACTATATTAGA, GCCATCTAATATAGTGTGAC, GTCAAGGGTTTTGATGTTCC and AACTCTGCAAACTCTGGTCC] to target exon 2. Donor DNAs were designed to delete exon 2 resulting in a change of amino acid sequence after residue 214 and an early truncation 9 amino acids later. (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Atxn2 Mutation: 87 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)