Ikzf3^em2Itan
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ikzf3^em2Itan
• Name: IKAROS family zinc finger 3; endonuclease-mediated mutation 2, Ichiro Taniuchi
• MGI ID: MGI:6885823
• Synonyms: Ikzf3^G158R:D461fs, Ikzf3^{G158R:deltac-ZF}
• Gene: Ikzf3 Location: Chr11:98355728-98436857 bp, - strand Genetic Position: Chr11, 61.75 cM
• Alliance: Ikzf3^em2Itan page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Insertion
• Mutation details: Using an sgRNA (targeting TGGTGAACATCACATAATCT in exon 8) with CRISPR/Cas9 technology resulted in the insertion of an A into aspartic acid codon 461, causing a frameshift that eliminates zinc fingers 5 and 6 from the encoded peptide. The allele was created in fertilized eggs carrying the Ikzf3^em1Itan allele. (J:319672)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ikzf3 Mutation: 33 strains or lines available

References

• Original: J:319672 Yamashita M, et al., A variant in human AIOLOS impairs adaptive immunity by interfering with IKAROS. Nat Immunol. 2021 Jul;22(7):893-903
• All: 1 reference(s)