About   Help   FAQ
Ikzf3em2Itan
Endonuclease-mediated Allele Detail
Summary
Symbol: Ikzf3em2Itan
Name: IKAROS family zinc finger 3; endonuclease-mediated mutation 2, Ichiro Taniuchi
MGI ID: MGI:6885823
Synonyms: Ikzf3G158R:D461fs, Ikzf3G158R:deltac-ZF
Gene: Ikzf3  Location: Chr11:98355728-98436857 bp, - strand  Genetic Position: Chr11, 61.75 cM
Alliance: Ikzf3em2Itan page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Insertion
 
Mutation detailsUsing an sgRNA (targeting TGGTGAACATCACATAATCT in exon 8) with CRISPR/Cas9 technology resulted in the insertion of an A into aspartic acid codon 461, causing a frameshift that eliminates zinc fingers 5 and 6 from the encoded peptide. The allele was created in fertilized eggs carrying the Ikzf3em1Itan allele. (J:319672)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Ikzf3 Mutation:  33 strains or lines available
References
Original:  J:319672 Yamashita M, et al., A variant in human AIOLOS impairs adaptive immunity by interfering with IKAROS. Nat Immunol. 2021 Jul;22(7):893-903
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory