Ikzf3^em1Itan
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ikzf3^em1Itan
• Name: IKAROS family zinc finger 3; endonuclease-mediated mutation 1, Ichiro Taniuchi
• MGI ID: MGI:6885821
• Synonyms: Aiolos^G158R, Ikzf3^G158R
• Gene: Ikzf3 Location: Chr11:98355728-98436857 bp, - strand Genetic Position: Chr11, 61.75 cM
• Alliance: Ikzf3^em1Itan page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Using an sgRNA (targeting GCAGTTTAATATGACGGAGG in exon 4) and an ssODN template (CCTTGTGATCAGCGATCTCCTTTTTCCTCCTTTCTGAAGGCGAACGCCCGTTCCAGTGTAATCAGTGCGGGGCATCTTTTACTCAGAAACGTAATCTCCTCCGTCATATTAAACTGCACACGGGGGAAAAACCTTTTAAGTGTCACCTCTGCAACTACGCATGCCAAAGGAGAGATGCGCTCACGGGACACCTTAGGACA) with CRISPR/Cas9 technology, a G>C mutation was engineered in glycine codon 158, changing it to arginine (p.G158R), to mimic a mutation (p.G159R) found in human patients with adaptive immunity defects (B cell developmental deficiencies and T cell abnormalities). (J:319672)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ikzf3 Mutation: 33 strains or lines available

References

• Original: J:319672 Yamashita M, et al., A variant in human AIOLOS impairs adaptive immunity by interfering with IKAROS. Nat Immunol. 2021 Jul;22(7):893-903
• All: 1 reference(s)