About   Help   FAQ
Kmt2aem4Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Kmt2aem4Lutzy
Name: lysine (K)-specific methyltransferase 2A; endonuclease-mediated mutation 4, Cathy Lutz
MGI ID: MGI:6885555
Synonyms: Kmt2aC1186Y
Gene: Kmt2a  Location: Chr9:44714652-44792594 bp, - strand  Genetic Position: Chr9, 24.84 cM
Alliance: Kmt2aem4Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsCRISPR/cas9 genome editing used guide RNAs (TATAAAGAAGCAATGCTGCAA, AAGAAGCAATGCTGCAAGTGA, and GAAGCAATGCTGCAAGTGAG) to target exon 5. Donor DNAs were created encoding a C1186Y mutation (TGC to TAC, cysteine to tyrosine). C1186Y is orthologous to the clinical mutation C1189Y associated with Wiedemann-Steiner Syndrome. (J:94077)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Kmt2a Mutation:  135 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory