Kmt2a^em3Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kmt2a^em3Lutzy
• Name: lysine (K)-specific methyltransferase 2A; endonuclease-mediated mutation 3, Cathleen Lutz
• MGI ID: MGI:6883728
• Synonyms: Kmt2a^del414, Kmt2a^indel
• Gene: Kmt2a Location: Chr9:44714652-44792594 bp, - strand Genetic Position: Chr9, 24.84 cM
• Alliance: Kmt2a^em3Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 genome editing used guide RNAs upstream (GGACCTGTAGTTTGAAATTC and GAATTTCAAACTACAGGTCC) and downstream (AGTAAGGATGATTGCAGCCC and GCTCACACAGTTTCCTGGCC) selected to target exon 2, sequencing identified a 414 nt deletion (indel mutation) that eliminates exon 2 creating a null allele. (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Kmt2a Mutation: 135 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)