About   Help   FAQ
Kmt2aem3Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Kmt2aem3Lutzy
Name: lysine (K)-specific methyltransferase 2A; endonuclease-mediated mutation 3, Cathy Lutz
MGI ID: MGI:6883728
Synonyms: Kmt2adel414, Kmt2aindel
Gene: Kmt2a  Location: Chr9:44714652-44792594 bp, - strand  Genetic Position: Chr9, 24.84 cM
Alliance: Kmt2aem3Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/cas9 genome editing used guide RNAs upstream (GGACCTGTAGTTTGAAATTC and GAATTTCAAACTACAGGTCC) and downstream (AGTAAGGATGATTGCAGCCC and GCTCACACAGTTTCCTGGCC) selected to target exon 2, sequencing identified a 414 nt deletion (indel mutation) that eliminates exon 2 creating a null allele. (J:94077)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Kmt2a Mutation:  135 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory