About   Help   FAQ
Ap4m1em1Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Ap4m1em1Lutzy
Name: adaptor-related protein complex AP-4, mu 1; endonuclease-mediated mutation 1, Cathy Lutz
MGI ID: MGI:6883702
Synonyms: Aprm1Q306X
Gene: Ap4m1  Location: Chr5:138170283-138178691 bp, + strand  Genetic Position: Chr5, 76.98 cM, cytoband G1
Alliance: Ap4m1em1Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsCRISPR/cas9 genome editing uses guide RNAs (CCCTCTGTGCAGTGGGACCA, GTGCAGTGGGACCAAGGCTC, and AGTCTCACCGGCCTGAGCCT) were selected to target exon 11. Donor DNAs were created encoding a Q306X mutation (CAA to TGA, glutamine to stop). The orthologous clinical mutation R306X is associated with hereditary spastic paraplegia. (J:94077)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ap4m1 Mutation:  34 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory