Ap4m1^em1Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ap4m1^em1Lutzy
• Name: adaptor-related protein complex AP-4, mu 1; endonuclease-mediated mutation 1, Cathleen Lutz
• MGI ID: MGI:6883702
• Synonyms: Aprm1^Q306X
• Gene: Ap4m1 Location: Chr5:138170283-138178691 bp, + strand Genetic Position: Chr5, 76.98 cM, cytoband G1
• Alliance: Ap4m1^em1Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: CRISPR/cas9 genome editing uses guide RNAs (CCCTCTGTGCAGTGGGACCA, GTGCAGTGGGACCAAGGCTC, and AGTCTCACCGGCCTGAGCCT) were selected to target exon 11. Donor DNAs were created encoding a Q306X mutation (CAA to TGA, glutamine to stop). The orthologous clinical mutation R306X is associated with hereditary spastic paraplegia. (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ap4m1 Mutation: 37 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)