Kcnq2^em8Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kcnq2^em8Lutzy
• Name: potassium voltage-gated channel, subfamily Q, member 2; endonuclease-mediated mutation 8, Cathleen Lutz
• MGI ID: MGI:6883657
• Synonyms: Kcng2^indel
• Gene: Kcnq2 Location: Chr2:180717372-180777093 bp, - strand Genetic Position: Chr2, 103.57 cM, cytoband H3-4
• Alliance: Kcnq2^em8Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 genome editing uses a guide RNA (GGTAGTCTACGCTCACAGCA) to target exon 4. The resulting indel mutation was identified as a 1 bp insertion (A) in the PAM site at aa 229. The mutation creates a frameshift mutation. (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Kcnq2 Mutation: 47 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)